PLANOS DE VIVIENDA DE 57M2 planos de viviendas pequeñas planos de casas pequeñas

Buscas planos de casas pequeñas? Aqui un plano muy bien distribuido de solo 57 m2 construidos + 3 m2 Terraza con 2 habitaciones, 2 baños, salón, cocina independiente, lavandería y terraza.
Se trata del proyecto Sun Towers en Natal en Brasil, destinado al uso multifamiliar para europeos que quieran disfrutar de los encantos de Natal. Aqui el plano de planta:
PLANOS DE VIVIENDA DE 57M2 planos de viviendas pequeñas planos de casas pequeñas
Cada complejo está integrado por 3 torres de 20 (veinte) plantas de altura cada una, con cuatro apartamentos por planta servidos por dos ascensores y escalera. Cada unidad está compuesta por sala de estar-comedor, terraza, dos dormitorios, siendo uno en suite, dos servicios completos, y cocina con area de servicio. Cada apartamento dispone de un garaje privado situado a nivel de calle.
El complejo dispone de 64 (sesenta y cuatro) plazas de garaje extra, distribuidas de la siguiente forma: 24 (venticuatro) plazas para visitantes, y 40 (cuarenta) plazas para comercialización con los propietarios de los apartamentos.
Cada Torre dispondrá del siguiente equipamiento específico:
TORRES A y B : Sala de espera, vestíbulo de entrada, administración, salón de fiesta, office, almacén, aseos, salón de juegos y terraza cubierta.
TORRE C: Sala de espera, vestíbulo de entrada, salón de actos, gimnasio, aseos, almacén y terraza cubierta.
ÁREAS EXTERNAS LAS TORRES: Piscina para adultos, piscina infantil, deck de madera, zona de juegos, área polideportiva (fútbol sala, baloncesto y voley), zona de arena, zonas ajardinadas.
Las cimentaciones serán proyectadas y ejecutadas de acuerdo con las Normas Técnicas de la ABNT, con base en los resultados de los sondeos del terreno y de las cargas de la edificación. Los proyectos y dirección de estas obras serán realizados por empresas técnicas especializadas y competentes. ESTRUCTURA Y El proyecto estructural es de hormigón armado en perfecta armonía con los elementos arquitectónicos e instalaciones, y obedeciendo a las prescripciones de las normas internacionales ABNT.La albañilería de cerramiento será en bloques de cemento o ladrillos cerámico en cualquier de los casos obedeciendo a las recomendaciones técnicas específicas.
Visto en: berzu.es
Via: Planos de casas

205 comentarios:


    1. Saludos..

      Diseño, construcción y venta.


      escribeme a este correo con todas las necesidades que requieras y te respondere a la brevedad posible, siendo mas especifico como en cada planta que requieres, para que etc,etc, bueno contactame y te oriento de mejor manera.

    2. hola necesito el plano de una casa que sea vistosa que tenga 3 dormitorios garage y un estudio a parte de lo de siempre gracias...

    3. hola soy arquitecto con gusto te atiendo llamame 7351300310

    4. hola con gusto te puedo ayudar a realizar tu plano de tu casa con algo novedoso y no los diseños que son prototipo, te gustara mi estilo mi cel 7351915067

    5. Hola, podría ayudarme con un plano en un área de 10.5 m * 25m , que en la planta
      baja sea totalmente libre y la segunda planta cuente con 3 o 4 mini departamentos parecido ala imagen plano de vivienda de 57 m2 considerando que el frente del terreno es de 10.5mt.

    6. Saludos estoy a la orden en proyecasa@gmail.com a sus ordenes!!!

  2. quiero un plano de 120 m2 o sea de 8 x 15 de fondo gracias


  4. Quisiera un plano, para contruir dos departamentos uno encima del otro. El terreno es de 112 mts cuadrados, 6 mts de frente por 19 mts.
    Con tres dormitorios,sala,comedor,cocina,patio,cocina y cochera para 2 carros. Me gusta las distribuciones que vi, pero no estoy segura si con esas medidas queden bien.

  5. quiero un plano de 105m2 osea d 7 x 15 de fondo

  6. Juan Leiva Benitez27 de enero de 2010, 7:42

    necesito un plano para una casa de aprox. 100 metros cuadrado, un baño grande en el primer piso, ademas un dormitorio. En le segundo piso tres dormitorio y una salita de estar. Desde ya garcias

  7. Juan Leiva Benitez27 de enero de 2010, 7:46

    necesito un plano para una casa de dos piso de aprox. 100 metros cuadrado, un baño grande en el primer piso, ademas un dormitorio. En le segundo piso tres dormitorio y una salita de estar. Desde ya garcias


    1. rendersmyhouse@hotmail.com.ar
      o facebook rendersmyhouse

  9. Tengo la inquietud, si se puede diseñar una casa de dos pisos de 3m de ancho y 22 de largo.

  10. Necesito un plano de una casa de 2.90 m de frente y 20m de largo. No hacia arriba.
    Desde ya muchas gracias

  11. hola alguien me puede decir cuanto debo invertir para construir una vivienda como el plano q esta aqui de 57 m2, con 2 habitaciones, salon, cocina inde,lavanderia, asi como donde puedo conseguir este plano ya con medidas para su desarrollo?

    1. Joven mi pregunta es te respondieron la preguta que hiciste porque yo tambien estoy bien interesado en este diseño de casa bagoz2004@yahoo.es

  12. Hola, necesito un plano para hace un monoambiente, la idea es en la planta baja dejar todo abierto. Dimensiones 5mt(ancho) X 10mt(Largo). La idea es despues de un tiempo crecer para arriba y utilizar el espacio aereo. Espero Respuestas. Dejo el mail superlucho1@hotmail.com

    1. owstia hacer una plano alli esta fuerte mejor es colocar un kinder e invadir un terreno ... porq alli esta muy belludo hacer la ... mejor mudate con tus padressss

  13. hola,me encantas sus planos y aprovecho para pedirles su ayuda, adquirí una casa de 50 m2 en una parcela de 150m2 quisiera que me ayudar a aprovechar el espacio realizando un plano para la ampliación de mi vivienda .puedo enviarles el plano de la casa para que tengan una idea. marbelysguillen@gmail.com,de antemano mil gracias.

  14. hola nesesito unplano para acer una casa de dos pisos abajo cocina,comedor,sala y un baño,ariba dos recamaras y una terracita en 55m2 toda la casa .....ramiron99@ive.com.mx mil gracias de antemano dios los bendiga

  15. hola necesito plano para una casa de 4 metros de ancho por 17 metros de largo con 2 alcobas 1 baño la cocina y un patio gracias.

    1. Saludos..

      dejo mis datos para que me contactes si sigues requiriendo lo antes mencionado.


  16. Buena
    Necesito que me ayuden a diseñar un plano en un terreno de 5mt x 11.5 mts.
    que conste de cocina, 2 dormitorios, sala-comedor, y 1 1/2 baño.
    esto seria de una planta.


  18. necesito me ayuden para construir una casa pequeña entre 56 y 70 metros cubiertos
    que tenga cocina-comedor,
    puede ser con lavadero incorporado, 1 baño, 2 dormitorios , y sala o living de ser posible con una pequeña estufa
    cuento con 7 metros de frente y puede ser 8 o 10 metros de fondo, ya que tengo que construir una placa porque el terreno tiene mucho desnivel
    es para la zona andina de venezuela
    es una aldea de dificil acceso para la entrega de materiales

    cuento con vuestra ayuda



  20. hola muy buenos dias quisiera un plano para una familia conpuesta por 5 personas es un terreno de 5 de ancho por 15 de largo bueno me encantaria que sea completa graciassss

  21. hola muy buenos dias quisiera un plano para una familia conpuesta por mi hija y yo es un terreno de 5 de ancho por 15 de largo bueno me encantaria q a lo ultimo tubiera un garaje me gustaria q fuera moderna pero no extrovertida

    muchas gracias

  22. Hola muy bonito el blog, quisiera que me orientes en la contrucción de mi casa de 115 mt2, tiene 5.16 metros de ancho X 22.35 metros de largo. (sala,comedor, cocina, 2 habitaciones, baños.)y una escalera con proyección para segundo piso. mi correo electronico es


  23. Por cierto mi correo es chikymori@hotmail.es, gracias

  24. voy a comprar una casa antigua con 220m cuadrados, y kiero reformarla en estilo moderno.
    Tengo una fachada de 7.5m a los 10m de profundidad se estrecha a 6.40m que consejos me dariais, me gustaria salon grande y concina amplia. Gracias

  25. hola quisiera que meorientes en la costruccion de micasa tiene 4 metros deancho x por 13 de largo de 2 pisos sala cocina lavanderia baño y 2do piso 2 cuartos yun pequeño patio mi correo es arovitecsol@hotmail.com si puedes enviarme algun plano muchas gracias

  26. buenos dia soy de ecuador que interesantes planos porfavor me pueden ayudar con dos planos uno de 8(frente)x15(largo) y el otro de 7(frente)x17(largo) que los dos planos tengan capacidad de dos carro para garage gracias me pueden enviar la información a mi email faby-is@hotmail.com

  27. Buenas tardes soy de Mexico me pudieran ayudar con un plano para un mini deprtamento 38 mts 7.5 de frente 5 de fondo. que tenga recamara, baño, cocina y estancia

    1. Que tal tmbien somos de México y podemos ayudarte.


  28. Hola soy de peru porfavor necesito un plano para mi casa 8 metros de frente y 10 metros de largo a futuro hacer de tres pisos en ella debe figurar dos tiendas adelante y 4 dormitorios, 2 cocina y 2 comedores en la parte posterior, los 2 dormitorios principales debe tener baños incorporados y dos normales, es que son para dos familias diferentes, Gracias por la ayuda, mi correo es mecha2406@yahoo.es


  29. Hola, por favor, necesito un plano de una casa de 115 m2 de 3 pisos, en un terreno de 6 mts de frente, con sala comedor cocina baño social en PB. En segundo piso dormitorio principal con baño . En tercer piso dos dormitorios con baño completo compartido. Agradezco mucho su ayuda.

  30. hola, tengo un terreno de 10 x 26 m cuadrados el fondo colinda con el cerro ,,asi q desearia construir departamentos 60 m2 ,,se puede contruir hasta 4 pisos


  32. Hola a todos los Lectores-videntes !!!!necesito con urgencia saber cuánto cuesta realizar un REPLANTEO para construir un Duplex (Buenos Aires Argentina )

  33. HOla a todos. Quisiera me ayuden con un plano para una casita de unos 80 metros cuadrados en dos plantas bien ventilada para un lugar super cálido!!. Gracias!!

  34. hola me llamo marisol y quisiera tener un plano de apartamento de un solo piso que tenga 3 habitaciones y la alcoba principal con baño y que tenga 7 metros de frente y 28 metros de fondo gracias los mas urgente

  35. me encantan todos sus proyectos .. vi tantos que no se cual se adecua a mis necesidades. tengo edificado 4 x 10mts y me gustaria reformar puedo utilizar la planta de arriba me dan una idea por favor.unico requisito 2 dormitorios. gracias alejandra.mi email es alejandraynesrojas@hotmail.com

  36. deseo un plano en un terreno de 180 metros cuadrados (10 de frente y 18 de fondo) y construidos 64 metros cuadrados (8 x 8 ) con un dormitorio, sala, comedor, cocina y sala de estudio

  37. hola muy bueno esto de los planos quiero construir un duplex en 4 metros de ancho por 15 de fondo si me pueden enviar los planos gracias

  38. Por favor necesito una casa de campo un piso de 120 m2 con ciertas caracteristicas 3 dormitorios con baño privado cada uno,sala, cocina, comedor, baño social.

    gracias su gentil ayuda att- xbravo. mi mail es:

  39. todo esta super bien
    necesito un plano de dos pisos realizado en autocad

  40. hola buenas tardes me puedes ayudar es que necesio un plano que sea de dos plantas el terrero mide 8 de frente y 10 de fondo. quiero cinco habitaciones, tres baños, cocina, comedor, lavanderia, estacionamientobueno que enga todo exctamente gracias


  42. busco un plano de una casa de cuatro metros de ancho por veinte de largo

  43. muy buena esta pagina........ y esta muy buen distribuido... tiene bastante funcionalidad

  44. a todos los que necesitan vivienda, si tienes terreno y vas a construir yo te construyo acredito el 50% para pagar en dos años el otro 50% para hacer la construcion maestro de obra graduado 12 años de experiencia trabajo en caracas o sus alrededores 04241871815 04142181026

  45. hola buen dia quisiera por favor un plano de vivienda de 3 pisos con terraza garage sala-comedor 3 habitaciones y 3 baños en un terreno de 4mts de frente por 13mts de fondo 52mts2 total gracias


  47. Antes que nada felicitarle por tener un espacio de esta naturalez y utilidad y pedir ,si le es posible ,que me envie a mi correo: cirsanno@yahoo.es unos planos para contruir dos pequeños departamntos en un terreno que mide 5 metros de frente y 24 metros de fondo,que incluya acceso independiente en cada planta,cocina baños ,salas y de ser posible tres habitaciones en cada una de las plantas.
    Enviandole mis mejores eseos y a la espera de su respuesta quedo de usted.
    Cirilo Sanchez N.

  48. Antes que nada permitame felicitarle por esta brillante idea de compartir esta pagina tan util e interesante.Aprovecho,tambien para pedirle,si es que esta en sus posibilidades ,que envie a mi correo: cirsanno@yahoo.es algun plano para construir un departamento por piso en un lote que mide 5 metros de frente por 24 metros de fondo y que aparte de su entrada independiente tengan cocina baño ,sala y 2 o 3 recamaras.
    sin mas por el momento le agradezco de antemano y le envio mis mejores deseos.
    Profr. Cirilo Sanchez N.

  49. para poder ver planos de 72mts2 como hago

  50. Hola, me puedes decir donde encuentro planos de una casa que tenga tres recamaras y un garaje para coche, el terreno es de 8.5 x 15 largo.


  51. ando buscando un plano para contruir mi primera casa.. mi terreno mide 12 de ancho con 20 de largo quisiera hacerla de 2 pisos con tres cuartos arriba y con sus 3 baños con un cuarto principal grande igual el baño los otros dos normales con sus baños la planta de abajo que tenga sala, estudio, comedor, cocina, lavanderia con garaje para 2 carro areas verde como alante y atras.. mi correo es jhole_dura@hotmail.com espero respuesta..

  52. hola antes que nada gracias por la ayuda,es increible tu blog... tengo un espacio de 4m de frente por 3m de fondo para hacer una entrada de casita de playa(una terracita) podrias por favor ayudarme? mil gracias andreainweb@hotmail.com

  53. Me encantaría que puedas ayudarnos, somos una pareja de 30 años de edad, mi padre (Carolina) nos ha donado parte del terreno de jardind e su casa para q podamos contruir nuestra casita...unos 100 m2...no se teniamos la idea de ahcer una casa sencilla de una sola planta..con 2 hab con placard empotrados, 1 baño, living y cocina. Aprox 50 - 54 m2 porq tenemos una perra y queremos dejar espacio de terreno de jardin. Podrías hacernos el plano, y darnos consejos de la distribución. Mi mail es cxbello@gmail.com
    Ustedes son empresa constructora? de donde son?

  54. Hola me gustaria que me ayudara con algunos planos para mi departamento de 1 planta y otra para la 2 planta para que ambas sean individuales.. es un espacio de 4.50mt de ancho y 18mt de largo en lo posible sea 3 dormitorios sala comedor cocina lavanderia y baño... mi correo es marili-4-5@hotmail.com .. muchas gracias (OJALA PUEDAN AYUDARME..)

  55. FIGUE.... hola sus planos son espectaculares.tengo un terreno cuyas medidas son 9 Metros de Frente por 10M de largo por 6Mde ancho en el fondo y me gustaria que me ayudaran en el diseño. Thanks.



  58. hola mi nombre es mariela tengo un espacio de 5m de frente por 12m de fondo primero hay que dejar un espacio de un metro para una casa pequeña que hay en parte de atras y el apartamento lo quisiera de 2 plantas y un altillo que tubiera sala comedor 2 alcobas un estudio mi correo en mapaca22@yahoo.es


  60. Hola mi nombre es Francisco queria consultarle lo sguiente: tengo un terreno de 10 mts x 21.5 mts y quisiera saber si es necesario dejar un espacio entre la pared del fondo y la vivienda que deseo construir o directamente puedo utilizar esta como pared de mi vivienda. Espero su respuesta de la cual estare muy agradecido, mi correo es freudjavi@hotmail.com

  61. Hola estoy viendo opciones para construir una casa de 100 - 120 mt2 en una planta ¿tienen planos que se adapten a esto?
    Muchisimas gracias

  62. Hola mi nombre es karina quisiera un plano de una vivienda en un terreno de 7.5 metros de frente y 45 metros de largo.Quisiera si es posible en una sola planta.Es posible?
    Espero su repsuesta mi correo es kariluja@hotmail.com....MUCHAS GRACIAS!!!!!!!!

  63. Hola tengo un terreno de 4.15 x 35. tienen planos que se adapten a este terreno? muchas gracias mi correo es fxmoya@hotmail.com

  64. hola tengo un terreno de 4.15 x 35 tendrian planos que se adapten a este muchas gracias, mi correo es fxmoya@hotmail.com

  65. hola, tengo un terreno de 4*7 busco sugerencia para distrubucion de sala comedor y escaleras, se puede, garcias

  66. hola tengo un terreno 12x21 quisiera que me ayeden aser un plano para la fabricacion de mi hogar tengo una idea como quiero que sea con 4 dormitorios con tres baños con patio , garage ,lavanderia,cuarto de estudio , sala.comedor,cosina

  67. hola tengo un terreno de 7metros de ancho por 14metros de fondo podría construir tres dormitorios con su sala y cocina y su baño y el tendero de ropa de lavar como podría distribuirlo

  68. Hola : dispongo de un terreno de 10m por 8m, al fondo de mi casa, y quisiera construir dos dptos para alquilar, los mismos deben ser de 1 dormitorio cada uno. Si me pueden ayudar estare muy agradecida

  69. buenas amigo tengo un terreno en una platabanda y mide 10 metros de ancho por 8 metros de largo y necesito con urgencia un plano con 3 habitaciones, sala comedor, cosina,lavandero, y 2 baños el principal y otro se lo agradesco de antemano

  70. Hola, tengo un terreno que mide 4 metros de ancho y 18 metros de largo, mi idea es de dos piso, que contenga garage, sala comedor cocina y un cuarto estudio en planta baja, en la parte de arriba seria 3 habitaciones 2 baños una sala de estar terraza y un peq espacio para lavanderia... necesito el plano urgente gracias de antemano, chavela870@hotmail.com

  71. buenos dias plis necesito con urgencia ayuda tengo un terreno de 3.90 de ancho por 7.20 de largo donde me gustaria un mini apartamento donde en la parte de abajo estubiera sala comedor, cocina, lavandero y un baño y en la parte de arriba dos cuartos uno con baño y otro mas pequeno y hacer una pequeña terraza de 1 metro de ancho sera que es posible muchisimas gracias de ante mano mi correo sugeis_9@hotmail.com

  72. hola amigos, por favor si me pueden ayudar, quiero construir dos minidepartamentos en un espacio de 9mt. de ancho por 14m de profundidad, si me ayudan con ideas, mi correo es durisimo1234@hotmail.com gracias

  73. hola buenos dias. Quisiera que me colaboraran con un plano para un apartamento de 6.5 m de frente X 10 m. La idea es tener 4 habitaciones, usolo baño, sala comedor y cocina. No hace falta el patio de ropas.

    Mil gracias.. mi correo es luzmarina028@yahoo.es

  74. Hola, buenas tardes. Quisiera saber si es posible que me colaboraran con un plano para modificar una casa de 5 habiataciones, tres baños, sala comedor,cocina, 2 patios y garaje pero es muy oscura; el area construida es de 6m de frente x 12m.

    Muchas gracias, my correo es: drueda1996@hotmail.com

  75. Hola, buenas tardes, los felicito por compartir sus maravillosos conocimientos.
    Quisiera saber si me pueden colaborar con un plano para modificar una casa de 1 planta, la cual consta de: sala-comedor, garaje, 5 habitaciones, 3 baños, cocina y 2 patios; el área es de 6m de frente por 12m de fondo.
    Es muy oscura y mal destibuida.

    Agradezco su valiosisima colaboración.

    Mi correo es: derueda1996@hotmail.com


  77. Hola! quisiera saber si me puende ayudar con el plano para una casa en planta alta, con 7mt de ancho y 11 de largo. Dos dormitorios, cocina, living - comedor, y un baño. Mi direccion es ye_yvr@hotmail.com.
    Muchas gracias!

  78. Hola felicitaciones por su labor me podrian ayudar en el diseño de mi casa sus medidas son 4 de ancho por 10 mts de fondo de 2 plantas quiero en la parte baja la cocina y sala comedor y en la parte alta los dormitorios el baño independiente y una habitacion pequeña de estudio mi correo es loli_osea_yo@hotmail.com..Muchas gracias

  79. necesitaría alguna idea o sugerencia, quiero construir un salon comercial no muy grande y arriba la casa o departamento. muchas gracias.
    mi correo es willyluna2002@yahoo.com.ar

  80. hola deseo un plano para un terreno de 6 metros de ancho por 8 de largo gracias urgente pporfa mi correo es jenny-782010@hotmail.com para 3 cuartos una cocina baño sala comedor a y el frente de mi terreno es del lado de los 8 metros osea el frontis gracias

  81. hola tengo una casa en un terreno de 10 mts 2 por 27.5 m2 o sean 275 m2 ahora quiero solicitarles su valiosa ayuda ´para que me realicen un plano para hacer cuatro casas una sobre otra con dos recamaras en la planta baja con sus propios baños, una linda cocina no tan grande,y aprovechar una terraza que tiene en la parte de atras de 10 mts por 4 m.
    vivo en Guadalajara, Jalisco, México,
    agradezco su atenciones, mi e mail. es azorhorta@hotmail.com

  82. hola necesito un plano de 3 metros y medio x15.50 tambien otro de 9 metros x 7.76 ambos de tres pisos por favor .muchas gracias

  83. Buenas tardes, necesito ayuda en el diseño de una casa sobre una superficie de 6 x 10m, en dos plantas, con cochera y 3 o 4 dormitorios. Desde ya, muchisimas gracias por su colaboración. Mail: germanteijeiro@yahoo.com.ar

  84. Hola,necesito un plano para una casa de 2 pisos en forma de L, esta debe constar en la 1ra. planta: sala comedor, estudio, 2 dormitorios, baño,cocina, patio, escalera, 1 pequeño hall y en la 2da. planta sólo 2 dormitorios, baño y terraza. Desde ya les agradezco por su colaboración. Quedo atenta a su pronta respuesta.

  85. hola buenas noches.. quisiera un plano de una vivienda comoda sencilla.de 3 habitaciones.. 2 baños uno en el cuarto principal y otro afuera para visitas pues.. una sala de estar, comedor..cocina y lavandero..

  86. buenas tardes... yo tengo un espacio en la parte de arriba de la casa de mi madre de 9 metros x 8 metros y quisiera saber si tienen un plano para construir una vivienda comoda se los agradeceria aqui les dejo mi email: rafaelsequeirapestana@hotmail.com muchas gracias...

  87. mi nombre es francisco y tengo un terreno de 5x20 y me gustaria que me ayudaran con un planito para construir una casita de una planta con 2 rec cocina sala comedor y baño, dejar un patiecito atras y adelante, mi correo es ccfrc_@hotmail.com
    espero que me ayuden,

  88. Buen dia.
    mi nombre es Humberto y me intereza construir una casa de campo de 4 habitaciones con 2 baños completos, cocina algo grande, sala amplia area de estar con una terraza en el frente para descanso en una superficie de 9 metros por 12 de preferencia que no sea totalmente cuadrada les agradezco y espero se pueda mil gracias mi correo humbert108@hotmail.com

  89. hola me gstaria me dieras la idea para construir una casa en un terreno de 5m de ancho x 15m de largo, a mi me toco en la parte de atras pues mi hermana ya construyó en la parte del frente del terreno necesito 2 plantas en la primera necesito sala comedor, cocina,1/2 baño y si se pudiera el studio. arriba necesito 3 recamaras y 1 baño ojala puedas ayudarme de antemano te lo agradezco infinitamente. mi correo es rosiluz_@hotmail.com

  90. Necesitaba un plano para una casa en estos metros: 4 m de ancho y 10 de largo, con dos dormitorios. muchas gracias



  93. hola excellente pagina y diseños me podrias ayudar con un palno para una casa de aprox 60 m2 de construccion en un terreno de 7*15 con 2 habitacioes gracias

  94. perdon no te di mi correo fcardenas62@hotmail.com para una casa de 60 m2 de const

  95. CATATATATATTATATTATA17 de julio de 2011, 11:37


  96. hola soy eugenia necesito saber que se puede armar en un terreno de 150m2 duplex o departamentos en alquiler..

  97. Hola soy ciber70@live.com NECESITO UN PLANO DE UNA CASA QUE MIDE 6 METROS DE FRENTE POR 20 METROS DE FONDO, NECESITO 1 SALA, 1 COMEDOR, 3 HABITACIONES , 1 BAÑO, 1 COCINA,1 ZONA DE LABORES Y 1 TERRAZA porfavor estoy muy confundida porque ya se esta construyendo la casa y todavía no sabemos como distribuirla

  98. hola necesito un plano para una casa lo mas pequeño que se puede con 2 habitaciones y que una de las babitaciones tenga adentro el baño, una sala y una cosina comedor y un baño independiente para las visitas, les voy agradecer si me envian uno al correo tieneelshow@hotmail.com

  99. HOLA....QUE BUENO CONTAR CON ESTA AYUDA...LOS FELICITO ME ENCANTARIA QUE ME COLABORARAN CON UN PLANO DE 2 APARTAMENTOS INDEPENDIENTES ...EL TERRENO es DE 12*6 ....lo desearia con 3 alcobas, sala, comedor, cocina, patio de ropa y lavadero, baño privado en la alcoba principal y otro fuera.En el segundo piso que lleve balcon...agradezco si e pueden colaborar mi correo es emilne-23@hotmail.com

  100. buenas tardes soy dre colombia y necesito urgente un plano de una casa de 2 plantas de 4m de frente por 13 de fondo abajo desearia sala,1 baño comedor cocina grande, 1 alcoba y lavanderia en la segunda 2 habitaciones pero en la principal deseo un cuarto de oracion que me quede dentro de mi cuarto de manera que cuando estudie no le moleste a mi esposo la luz la habitacion principal la quiero con un ventanal grande no se cuantos baños quedarian bien y una sala pequeñita con el estudio porfa les agradezco su colaboracion mi correo emdaliro22@hotmail.com

  101. hola soy de lima peru seria buena honda de su parte si me diera opciones de planos.vera ud mi casa es de 60mt de ancho y 90mt de largo quiero costruir mi casa para negocio solamente corralon con techado con una fuerte base que soporte hasta 5 pisos le agradeceria que me mandara opciones de planos para esa construccion por siacaso mi correo es thom_172487@hotmail.com gracias

  102. hola vivo en panama me gusto el plano de57mts podrian manderme las medidas para estudiar un posible duplex mi correo es sergio6223@hotmail.com gracias

  103. whaoo e visto tus planos y todos me guataron mucho q padre q compartas tu talento con todos nosotros

  104. Me gustó el plano de 57 m2, podrías enviarme a mi correos rolyreyes2003@yahoo.com.ar las medidas del mismo y cálculo en las columnas y vigas. Yo quiero construír para mis hijos en el fondo de mi casa algo similar. Cuento con un frente de 15 mts. por 20 de fondo, puede ser diseñado hasta de tres plantas, para un futuro.

  105. Buen día. Quisiera un plano para una casa de 2 plantas que sea cómoda, con terraza, baño en las habitaciones, uno de visitas, cocina, lavandería, sala, comedor, biblioteca, sala de estar, en un terreno d 3.5mx12m para una familia d padre y madre, 1 niña y 3 niños. Muchas gracias.

  106. Hola Buen Día y Felicitaciones. Muy profesionales de verdad. Quisiera que publicaran planos de viviendas de 64 Metros Cuadrados. en Terreno de 8.45 X 8.45 .- Gracias de Antemano


  108. por favor arquitectos e ingenieros necesito un plano de casa de 6 metros de frente p0r 46 de fondo, primer nivel cochera para 2 autos sala comedor, cocina con desayunador, baño, si es posile un pequeño jardin y 2 cuartos con baño,puede ser cada uno o compartido. planta alta 2 cuartos cada uno con baño, cuarto para tv,bodega . muchas gracias. leticiacorvel@hotmail.com

  109. hola tengo un terreno de 3metros frente x 40 metros largo.deseo construir 3metros x 25metros.tengo 3 hijos y me encantaria q me haga llegar una distribucion apropiada para vivir comodos con mi esposa e hijos.mi idea es construir hasta segunda o tercera planta.agradesco anticipadamente me haga llegar un plano adecuado a mis requerimientos.ah los ultimos 10 metros de fondo tengo sembrado arboles frutales y rosales.mi correo es gerchu1202@hotmail.com

  110. por favor necesito el plano de casa de 7 metros de frente por 10 de fondo, primer nivel cochera para 2 autos y local con pequeño jardín segundo nivel 2 cuartos con baño, cocina comedor y biblioteca muchas gracias. isabel_talavera@hotmail.com

  111. hola me podrian ayudar quiero ideas para un departamento en la segunda plata de la casa de mi mamà, el lugar mide 56metros cuadrados, me gustaria con tres habitaciones la principal y dos mas pequeñas, sala, comedor,cocina,cuarto de pila, un balcon pequeño, y baño... muchas gracias!!!

  112. por favor me podrian ayudar necesito construir un departamento arriba de la casa de mi mamà el lugar mide 56 metros cuadrados me gustaria con tres dormitorios el principal y dos mas pequeños, sala, comedor, cocina, cuarto de pilas,baño y un balcon pequeño.. les agradeceria mucho de su asesoria mi correo es danymiche@hotmail.com

  113. Hola soy de venezuela, sera que me pueden ayudar con un plano para una casa de dos pisos. la cual tenga una habitacion, sala, cocina comedor y un baño en el primer piso, y en el segundo piso dos o 3 habitaciones, una con sala de baño, y na terraza...antemano muchas gracias por la ayuda que me puedan brindar. mi correo es carlotamedina@hotmail.com

  114. hola como estan, un placer ver sus planos, ideas y la capacidad de hacer mucho en pocos espacios.
    yo tengo un terreno de 6 metros de ancho por 60 metros de largo, mi idea es al fondo hacer mi casa y en la parte de adelante tener departamentos para alquilar hasta de tres plantas, al igual que deseo tienda para lo mismo, estoy en duda con el tema de garaje y de como distribuir todos los espacios. por favor espero que me ayuden, les dejo mi email liroy_zc@hotmail.com gracias.

  115. buenes tardes arquitecta.le agradezco de antemano , me gustaria saber si me podria ayudar con un plano para construir una casa de dos plantas con habitacion matrimonial y una para visita con ,sala comedor dos banos,garaje y una pequena piscina en un lote de 10x25 osea 250m°10 son de ancho y 25 de largo. gracias

  116. tenemos una casa de 6m x 10m de largo,nos ayudaria mucho alguna idea de como poder redistribuirla......en la planta baja a poder ser un estudio,un salon ,comedor baño y cocina,solo el frente tiene ventanas.En la planta de arriba que solo tiene 40m necesitariamos 2 habitaciones mas un baño.Muchas gracias por su ayuda ,si consiguiera hacer esto mi correo es soyjou@yahoo.es

  117. Quiero ampliar una recámara de 3x3 hacia el patio trasero de la casa, a todo lo largo, es decir, quedaría un solo cuarto de 3 x 9 (aprox) con un baño incluido, qué sugerencias me pueden dar y cómo sería el plano? gracias por la ayuda

  118. hola quisiera un plano para una vivienda de los niveles necesarios para una familia con tres hijas y dos vehiculos mas una moto. el parqueo puede ser un deprimrido ah con terraza en el ultimo nivel, mi correo latorremauro@hotmail.com

  119. soy fco. manuel piña diaz y trabajo aluminios y cristales en cd. cardel veracruz mexico. un cliente me pidio una canceleria del modelo villa prisma de reisa.com. necesito las medidas alto por hancho,la linea del aluminio,color y grosor del cristal. porfabor me urge y me pueden escribir a: francisco155@hotmail.com


  121. necesito un plano de 120m2 10por12 en la 2 planta quiero 2 pisos gracias mi correo es bueno2011bueno@hotmail.com

  122. hola: quisiera un plano para mi viviendat de 5 metros de frente por 9 de largo,tiene una area construida de 5 por 4(desde la entrada es sala comedor, y un baño),en los 5 por 6 restante quiero una pequeña cocina,terraza y un dormitorio con baño,en una planta,para mi comonidad. . gracias. . .! mi correo es doliplasdi25@hotmail.com

  123. la casa de mi mama es de 100 metros cuadrados y queremos hermanos construir 4 pisos y q tenga 3 dormitoriosx cuarto

  124. buenas noches por favor ayudenme requiero un plano para orgsanizar mi casa en un espacio de 7.3 metros de ancho por 12 de largo.vivo con mis tres hijos adolescentes y yo que soy su madre.igual me gustaria dejar un espacio para garaje .soy de vebnezuela mi correo es belkysfonsecadiaz@hotmail.com

  125. hola gracias por la oportunidad de ayudarnos
    Quisiera un plano para una casa, tengo 8 metros del frente por 12 metros de largo. En el primer piso quiero un dormitorio ampleo con bano privado, otro bano completo extra, sala, comedor,cocina y lavanderia y en el secundo piso 3 dormitorios con bano completo y sala. gracias por su ayuda
    mi email es deybaby06@aim.com


  127. Estoy sorprendida por la cantidad de gente que quiere un hogar cómodo con varias habitaciones, biblioteca, terrazas, estancia, lavandería etc etc etc etc, en terrenos minis minis, pero minis, no lo puedo creer!!!!, sin embargo, dicen por ahi que cualquier arquitecto diseña buenas casas en terrenos amplios, pero los verdaderos arquitectos son los que diseñan casas cómodas en terrenos tan pequeños como los que tienen todos los aqui presentes, en fin les deseo que cumplan con su sueño de una casa comoda con todas las habitaciones que deseen, saludos!

  128. Buen día

    Soy Arquitecto y quiero mencionarte algunos beneficios en los cuales te puedo ayudar.

    • Contribuir a elevar la calidad de vida de la comunidad.

    • Mejorar el confort y las condiciones de habitabilidad de las construcciones.

    • Dar la tranquilidad y confianza de un respaldo profesional.

    • Optimizar las inversiones ahorrando materiales y dinero.

    • Planificar junto a las personas el crecimiento de su vivienda.

    Es comun que las personas tomen un diseño de una casa visto desde una pagina de internet, me gustaría mencionarle que cada proyecto, y en especial cada espacio habitable se debe de adecuar con la orientación idónea dependiendo al lugar donde este se localice.

    A veces es fácil tomar un prototipo que a la larga resulta con ciertos inconvenientes como cuartos que quedan muy fríos o calientes, sin una buena ventilación o una mala vista interior hacia el exterior.

    Y es ahí donde yo puedo orientarlo, no importa que no este en su ciudad, ya que podemos coordinar el proyecto via mail y realizar las visitas necesarias donde usted se encuentre con la finalidad de ofrecerle la mejor atencion que requiere para sus necesidades de proyecto.

    Le mando un Cordial Saludo.


    Arq. Javier Salinas.

    a r q + t e c t u r a



    México D.F.

    Tel. Cel. 044 55 28 89 22 66

  129. hola como estan, un placer ver sus planos, ideas y la capacidad de hacer mucho en pocos espacios.
    tengo una parcela de 450m2, 15x30, mi idea es construir en dos planta, en pb servicios y em la planta alta habitacion principal mas dos adicionales. por favor espero que me ayuden, les dejo mi email jose_rojas100@hotmail.com

  130. Alejandro Laimito Necesita si por favor le pueden enviar un plano para una casa de 7,50 fondo x 6,40 m frontera. La idea es construir 2 pisos, espero cordialmente respuesta.

  131. Hola mi nombre es Roger, de peru mira tengo un terreno de 7.4*15.6, el problema esque en este van a viir dos familias, quieren que el primer nivel tenga cochera el sehundo nivel para una familia el tercer nivel para la otra familia y la terraza dividad en 2 porfavor espero me puedan ayudar

  132. Lidia dijo
    Si puede ayudarme, por favor con un plano para una casa de dos plantas tipo minimalista combinado con colonial, 7 de frente y 10 de fondo,en la planta baja living comedor cocina y ba'o de visita en la planta alta dos dormitorios bano , mi correo es lzurita@guabira.com


  134. ola tengo un terreno de 7 de frontera por 22 de fondo quisiera un plano sencillo pero que lusca elegante. besos gracias

  135. hola me gustaria que me ayude con un plano para mi casita el terreno tiene 6metro de ancho y 16 metro de largo tiene que tener garaje y 3 cuarto quiero que sea sala comedor y cocina y lavadero

  136. tengo un terreno de 6.5 m de ancho y 22m de largo me gustaria construir una casa de dos plantas con jardin, lavanderia, cocina y comedor, estudio, en el segundo piso me gustarian dos recamaras y na principal con walking closet, mi correo es lethal_3@msn.com gracias!!!!

  137. hola , quisiera una asesoria para un espacio de 8m por 11m , de tres hab., 2 baños, cocina comedor, garaje y porche. con el lavandero abajo y un espacio de estar como terraza arriba. le agradezco su ayuda ya que no se como distribuirlos. mi correo teran676@gmail.com...

  138. hola buenas noches m llamo jorge no se si m pueden ayudar con un plano tengo una familia de 3 hijas y mi esposa en total somos 5 personas quisiera si fuera posible ayudarm con un plano tengo un terreno de 6 * 20 grasias por la ayuda mi correo es jorgemoran79@hotmail.com grasias

  139. hola buenas noches quisiera algunos consejos para un espacio de 4mt por 15mts jardin,dormitorio,baño,cocina, sala..somos 2 personas agradesco su ayuuda ...
    mi correo es samayoa_a@yahoo.com

  140. buenas tardes un saludo cordial me gustaria que me ayudaran con un plano de una casa de dos pisos preferiblemente toda el area de servicio en planta baja de 120 mt2y almenos 03 habitaciones con baño y medio baño en planta baja gracias cdrobert@hotmail.com

  141. hola buenas noches desearia unos consejos para un espacio de 6m x 8m de dos plantas en la primera planta sala, comedor, cocina y baño los cuartos en la segunda planta somos una familia de 6 personas si fuera posible ayudarme con un plano se los agradesearia mi correo es pelayo1971@hotmail.com

  142. Hola, soy arquitecta, ofrezco mis servicios para realizar planos arquitectónicos, eléctricos o de fontanería. Precios cómodos y negociables. soniahidalgoz@hotmail.com

  143. buenas noches necesito que me ayuden tengo un terreno de 4mts de ancho y 10mts de largo megustaria abajo living,cocina comedor y baño y en la planta alta 2dorm y baño desde ya muchas gracias por su atencion le dejo mi correo juarez-miguel@hotmail.com

  144. Tengo un terrero urbano de 6.20 x 15.50 y quiero contruir 3 plantas independientes con 3 alcobas cada una quisiera que me dieran ideas

  145. hola me gustaria que me pudiesen ayudar con un plano o mas si se pudiera de un terreno de 4 mts de frente y 20 de largo ya sea para un piso o dos pisos.mi correo es maryta_la_buenita@hotmail.com

  146. hola que bueno que existe esta pagina,si me pudieran proporcionar planos de casa con jandin el terrono mide 8*10 pero pero esta en orilla de baranco sera que se puede contruis una casa ahi, o que soluciones me da y de cuentos pisos se puede, el terreno es solo de aplanarlo. por favor me urge necesito construir . mi direccion de correo electronico es www.lourdes@hotmail.es en el correo siempre de poner mi nombre siempre va www. porque si no no me lo envian, a la estare esperando respues

  147. Nesesito un plano para un terreno de 6mx15m con 3 dormitorios sala comedor,cosinoa,2baños y escalera independiente agradesco si me pueden ayudar

  148. Que bueno que hay esta pajina pra ber si pueden ayudarme tengo un terreno de 90m2 de 6m de frente y 15m de largo.Nesesito un plano con 3 dormitorios,2 baños,sala comedor,cosina,labanderia y escalera indibidual mi correo electronico es leo-argomedo@hotmail.con.


  150. Hola que bueno tener buenas ideas, necesito un plano para un terreno de 4 metros de ancho x 8 metros de largo, vivimos una pareja y una hija, tenemos casas a los lados, como puedo hacer mi casa. Les agradeceria su apoyo. Gracias. Mi mi correo es karla93dama@yahoo.com

  151. hola mmmmm necesito un modelo para decorar mi cuarto ke es de 3x5 osea 15 m2
    porfas ayudenme

    1. Hola José, te sugiero ver primero
      para que te des una idea en la distribución. Luego visita:

  152. Hacemos planos para todo publico
    Visiten nuestro sitio:


    Tambien deseamos saber posibilidad de intercambio de links en pagina de inicio con planosde casas.blogspot.mx favor de ponerse en contacto con nosotros..saludos cordiales..

  153. hola necesito un plano de 10 x 10 osea bien dividido la parte baja con sus abitaciones y
    cocina, sala y su cochera....


    1. Que tal... te dejo mis datos por si todavia requieres y necesitas diseño, construcción que es a lo que nos dedicamos.


  155. hey hermano...nesecito un plano de 8 de ancho y 20 de largo ..q todas las habitaciones de la 1 planta y la segunda esten iluminadas porfaaaaaaaaaaaaaaaaa

  156. hey hermano nesecito un palno de 8 de ancho y 20 de largo q la 1 planta y la 2 planta tengan sus habitaciones ilumunadas porfa

    1. Buenas tardes:
      para un mejor entendimiento quisiera saber si piensa construir este departamento con licencia, ya que si es asi los municipios exigen ciertos parametros tales como: area libre, retiro frontal, retiro posterior, altura maximo de edificacion, entre otros.
      ademas que si es con licencia les van a pedir planos de especialidades (planos electricos, planos sanitarios y planos estructurales) todos sellados y firmados por los respectivos profecionales.
      pero si piensa construirlo sin licencia creo que con el plano de arquitectura bastaria, si es asi podria cobrarle por el plano 3 soles por metro cuadrado (ojo solo arquitectura impreso y en un cd) sin sello ni firma del arquitecto.



      mail: arqwasi@hotmail.com

  157. hola muy buena la pagina me pueden alludar quiero contruir 2 departamentos sin medinera dispongo de 10mtrs x 6 de largo es para dos flias de 3 personas cada una gracias espero respuesta

  158. hola cono estan me gustaria que me dieran la idea de como costruir en un terreno un apartamento pequeño que tiene 4mtros de ancho x 15 de largo que tenga 2 dormitorios 1 baño 1 cosina ojala me puedan ayudar de antemano se lo agradezco me responde ami correo rodo200981@hotmail.con

  159. Hola,es un gusto saludarles y saber que aun hay personas como ustedes que les gusta ayudar a otras,tengo un terreno de 30 m. de frente por 15m.de fondo me gustaria me ayudasen con un plano para una casa de una planta,que tenga una sala,comedor y cocina grande en un solo ambiente estilo americano y que sea muy amplio para familia numerosa ,una habitacion con vestidor y baño muy amplia, dos habitaciones que lleven armarios y que entren camas de matrimonio otro baño y un aseo para visitas,un cuarto de lavanderia y un garaje para un coche,un patio o jardin muy grande que vaya en el centro, para despues hacer una piscina y una barbacoa, y si me gustaria con ventanas o puertas corredizas en la sala y el comedor con vista para la piscina y un corredor para poner muebles de sala y comedor alrededor de la piscina y entre mucha claridad,estare muy agradecida por su ayuda,muchas gracias.silviki1961@hotmail.com

  160. Buenas noches, exelente pagina, tengo un terreno esquinero que consta por el oriente 9.50m con via vehicular. por el norte 9.00m con vivienda. por el sur 9.50m con zona de parqueo. por el occidente 13.50m con viviendas.nesecito orientacion mediante plano, un piso que tenga sala comedor, garaje,cocina,lavadero,dos baños, patio amplio y las alcobas que sean posibles,escaleras para posterior segundo piso; el clima es un poco caliente. gracias por lo que me puedan colaborar. my correo feraldana2562@hotmail.com

  161. BUENOS DIAS, MUY BUENAS IDEAS, TENGO UN TERRENO Q CONSTA DE 4m x 14m, y necesito un plano con dos pisos con local en el frente de cada uno de los pisos y con apartamento detras de cada un de los locales

  162. Hola necesito que nos ayuden! Tenemos un terreno de 12 x 42 mtrs. Pero solo queremos usar 12 x 20 mtrs: que conste con un garage/quincho que pase al patio; y en la vivienda 1 living,1 comedor amplio,cocina, 2 habitaciones y una de ellas con baño interno; 1 baño con antebaño, 1 sala de juegos, 1 biblioteca y 1 lavadero.Espero de su ayuda! gracias!!!


    1. qk pendejo piiensas qk te boii a soluzionar thu problema

  164. grasiiaz pero no me siirbe

  165. Hola tengo un espacio de 40 M2,en los aires de una casa,necesito que me ayuden por favor con los planos para una sala,comedor,cocina y un baño en un piso.luego en el siguiente el dormitorio principal y otro para dos chicas señoritas.en el siguiente piso dos o tres dormitorios y una terrazita.cada piso con su respectivo baño.mi correo es gesal16@hotmail.com,gracias por su ayuda.

  166. Hola buena tarde necesito un diseño de casa estilo colonial, que contenga el primer nivel garage, dos dormitorios, sala, cocina y comedor y lavandería y un pequeñito patio de un terreno que mide 8x16. Mi correo es sagitario739@hotmail.com Gracias por su ayuda.


  168. hola amig@s, primera vez q entro a este blogs y esta interesante. Les comento que me dedico al diseño arquitéctonico y actualmente a la ing. de instalaciones hidrosanitarías, espero les pueda ayudar en cual quier forma.
    les dejo mi correo para estar en contacto,salu2 a to2 y gracias...

    pd. Feliz año 2013

  169. Hola tengo un terreno de 7.5m de ancho por 12m de largo, quisiera hacer 6 minidepartamentos, dos minidepartemento por piso, cada mini con solo una habitacion, cocina integrada a la sala, un baño, etc. mi terreno solo tiene un frente (7.5m), alguien que me pueda ayudar, gracias. robert28pe@hotmail.com

  170. Hola, tengo una casa que voy a remodelar y quisiera que me den una idea, es un espacio de 5mt de frente por 10mt de largo, con 2 cuartos, cochera y una escalera independiente para un segundo piso.
    espero puedan ayudarme

  171. hola buenas tardes necesito de su ayuda referente a un plano para mi casa tiene 12 mts de ancha y 19 de largo quisiera hacer 3 cuartos con un baño el principal y uno quede afuera sala comedor cocina y un pequeño lavandero y con accseso a futuro hacerla de de 2 pisos que mas adelante no tenga problema para hacer las escaleras y que sea de platabanda garcaias le agradesco desde venezuela .mil garcaias antemano


  173. Hola tengo un terreno de 9 de frente y 23 de largo con 30 de ancho atras como veraz es irregular y esta desbancado 2.50 qusiera utilizar 13metros y al frente area verde pues me gustan los animales y las plantas una pequena area de B BQ 4 dormitorios etc y garage con prospecto de otro piso arriba para despues le agradesco mucho por su ayuda mi mail es pulsar0.01@hotmail.com

  174. hola quiero endibujo bien nitido del dibujo de casa donde estoy escribiendo este comentario por favor si alguien tiene una web donde pueda encontrar este modelo de casa de 70m2 asi com esta con el dibujo ya terminado y en modo plano con ficha tecnica y wl plano qe este muy bien nitido y en tamaño grande que sea mas de 1024x 360 a mas escribir a alex_capricornio13@hotmail.com con el link para hacer en enlace y abrir desde mi correo gracias

  175. Hola me gusto mucho el plano de 57m2, me gustaria saber si me lo puedes enviar a mi correo con las medidas respectivas.
    De antemano te lo agradezco mucho
    Mi cuenta es cynthiakgg@gmail.com

  176. Buenas noches quisiera saber si me pueden ayudar con unos planos tengo un terreno de 4 metros de ancho y 15 metros de largo quiero construir una casa de tres pisos con cochera, sala, comedor,cocina, 4 cuartos, cada cuarto con baño y una terraza en el segundo piso.
    Mi correo es mana12_9@hotmail.com
    Les agradesco mucho
    Gracias Saludos

  177. Hola soy de hoy mexico quisiera saber el.costo aproximado.de un plano para una casa en mexico.el terreno tiene 8 metros de frente por 17que de largo me gustaría un poco de ayuda para distribuir bien los espacios quedó construir dos plantas pero quiero que la construcción pueda resistir una planta mas para construcción a futuro

  178. Buenas tardes: Somos una pareja recien casada y quisieramos que nos ayuden con un plano para la construccion de nuestra casa en un area de 104 metros cuadrados, 8 de frente y 13 de largo, lo que deseo es una casa de 02 pisos, claro que primero haremos solo el 1r por cuestion de dinero, queremos que tenga: Sala, comedor, cocina, 02 dormitorios uno de ellos con baño propio y un baño comun y un area de lavanderia. El area es solo para casa en si el terreno es mas grande para el tema de los jardines. Favor escribirme al correo eoliverp@gmail.com

  179. Gracias por tu blog. Desde hace años como familia hemos deseado tener una casa propia. Vi el plano de la casa en 57 m2 y creo que podríamos lograrlo. Sería posible que me enviaras el plano de la casa en 57 m2 con las medidas exactas. Mi esposa y yo estaremos eternamente agradecidos.
    Mi correo es orellanaorlando8@gmail.com

  180. hola soy de venezuela necesito por favor un plano para una casita pequeña de dos cuarto un baño, sala y cosina peq ah y el lavadero. por favor lo mas economico posible gracias.....

  181. hola quisiera saber de plano de mi departamento lo quiero de cuatro de frente por doce de largo es dos planta y donde se puede poner la escalera gracia
